Question Bank Directory

Browse and search thousands of solved questions for your preparation.

Free · Highly Important · 15,000+ MCQs

NEET Chapter-Wise Practice Questions

Free questions with full explanations — locked behind signup to protect quality.

Browse All
Found 1968 questionsFilter: biology
BIOLOGYReproductive HealthEasy

A childless couple can be assisted to have a child through a technique called GIFT. The full form of this technique is:

View Full Solution
BIOLOGYReproductive HealthEasy

Hysterectomy is surgical removal of:

View Full Solution
BIOLOGYReproductive HealthEasy

Tubectomy is a method of sterilisation in which:

View Full Solution
BIOLOGYReproductive HealthMedium

Given below are four methods (A-D) and their modes of action (1-4) in achieving contraception. Select their correct matching from the four options that follow: Column I A. The Pill B. Condom C. Vasectomy D. Copper T Column II 1. Prevents sperms reaching cervix 2. Suppress sperm motility 3. Prevents ovulation 4. Semen contains no sperms

View Full Solution
BIOLOGYReproductive HealthMedium

Which of the following is correct regarding HIV, hepatitis B, gonorrhoea, trichomoniasis?

View Full Solution
BIOLOGYReproductive HealthMedium

Cu released by CuTs plays a role in:

View Full Solution
BIOLOGYReproductive HealthMedium

What is false for ZIFT?

View Full Solution
BIOLOGYReproductive HealthEasy

Which of the following diseases is/are not completely curable?

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

The experimental proof for semiconservative replication of DNA was first shown in a:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

Commonly used vectors for human genome sequencing are:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

DNA or RNA segment tagged with a radioactive molecule is called:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the?

View Full Solution
BIOLOGYMolecular Basis of InheritanceMedium

Which one of the following experiments of Frederick Griffith resulted in the discovery of bacterial transformation?

View Full Solution
BIOLOGYMolecular Basis of InheritanceMedium

Removal of RNA polymerase III from nucleoplasm will affect the synthesis of:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

In the process of transcription in Eukaryotes, the RNA polymerase I transcribe -

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

The lac Operon consists of:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

What initiation and termination factors are involved in transcription in prokaryotes?

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

Which of the following statement is correct regarding the process replication in E. coli?

View Full Solution
PreviousPage 65 of 99Next