Browse and search thousands of solved questions for your preparation.
Free questions with full explanations — locked behind signup to protect quality.
A childless couple can be assisted to have a child through a technique called GIFT. The full form of this technique is:
Hysterectomy is surgical removal of:
Tubectomy is a method of sterilisation in which:
Given below are four methods (A-D) and their modes of action (1-4) in achieving contraception. Select their correct matching from the four options that follow: Column I A. The Pill B. Condom C. Vasectomy D. Copper T Column II 1. Prevents sperms reaching cervix 2. Suppress sperm motility 3. Prevents ovulation 4. Semen contains no sperms
Which of the following is correct regarding HIV, hepatitis B, gonorrhoea, trichomoniasis?
Cu released by CuTs plays a role in:
What is false for ZIFT?
Which of the following diseases is/are not completely curable?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately:
The experimental proof for semiconservative replication of DNA was first shown in a:
Commonly used vectors for human genome sequencing are:
DNA or RNA segment tagged with a radioactive molecule is called:
DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the?
Which one of the following experiments of Frederick Griffith resulted in the discovery of bacterial transformation?
Removal of RNA polymerase III from nucleoplasm will affect the synthesis of:
In the process of transcription in Eukaryotes, the RNA polymerase I transcribe -
The lac Operon consists of:
What initiation and termination factors are involved in transcription in prokaryotes?
Which of the following statement is correct regarding the process replication in E. coli?