NEET Biology Core Repository
NEET Biology Solved Question Bank
Browse 1,000 verified, high-yield multiple-choice questions organized across 21 chapters. Every question includes detailed rationales, option breakdowns, and NCERT-aligned solutions.
All Chapters & Topics
Jump directly into any chapter to study solved MCQs with complete explanations.
General
Which of the following characteristics is incorrect with respect to cockroach?Which one of the following is an example of Hormone releasing IUD?Bilaterally symmetrical and acoelomate animals are exemplified byThe plant hormone used to destroy weeds in a fieldMutations in plant cells can be induced by:Match Column-I with Column-II.Select the favourable conditions required for the formation of oxyhaemoglobin at the alveoli.Which of the following plants is monoecious?
+ 226 more questions in this chapterBrowse Chapter Questions
Molecular Basis of Inheritance
Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately:The experimental proof for semiconservative replication of DNA was first shown in a:Commonly used vectors for human genome sequencing are:DNA or RNA segment tagged with a radioactive molecule is called:DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the?Removal of RNA polymerase III from nucleoplasm will affect the synthesis of:
+ 155 more questions in this chapterBrowse Chapter Questions
Reproductive Health
What does RCH stand for?Artificial insemination means:Statutory ban on amniocentesis in India was necessary because:One of the legal methods of birth control is:Oral contraceptive pills are composed of:IUDs:
I. Increase phagocytosis of sperms
II. Release Cu ions that suppress sperm motility and fertilising capacity of sperms
III. Make the uterus unsuitable for implantation
IV. Make the cervix hostile to sperms
V. Prevent semen from entering the female reproductive tract.
Which of the above statements are true?Sterilisation in males is ____________ and in females is ___________:Which of the sets of diseases are completely curable if detected early?
+ 109 more questions in this chapterBrowse Chapter Questions
Evolution
Industrial melanism is an example of?After about how many years of the formation of the earth, life appeared on this planet?Genetic Drift occurs due to :Ernst Haeckel's embryological support for evolution was disapproved by:A gene locus has two alleles A, a. If the frequency of dominant allele A is 0.4, then what will be the frequency of homozygous dominant, heterozygous and homozygous recessive individuals in the population?Match List-I with List-II:
List-I (Era)
A. Mesozoic Era
B. Proterozoic Era
C. Cenozoic Era
D. Paleozoic Era
List-II (Dominant Life Forms)
I. Lower invertebrates
II. Fish & Amphibia
III. Birds & Reptiles
IV. MammalsVariations caused by mutation, as proposed by Hugo de Vries, are:The process by which organisms with different evolutionary history evolve similar phenotypic adaptations in response to a common environmental challenge is called:
+ 57 more questions in this chapterBrowse Chapter Questions
Principles of Inheritance and Variation
Select the incorrect statement:Which of the following statements is not true of two genes that show 50% recombination frequency?In pea plants, yellow seeds are dominant to green. If a heterozygous yellow-seeded plant is crossed with a green-seeded plant, what ratio of yellow and green-seeded plants would you expect in F1 generation?Which one of the following is an example of polygenic inheritance?The genotypes of a husband and wife are IAIB and IAi respectively. Among the blood types of their children, how many different genotypes and phenotypes are possible?Mental retardation in man occurs due to:Given below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): A father will never pass the gene for haemophilia to his sons.
Reason (R): Haemophilia is sex-linked (X-linked recessive trait).
In the light of the above statements, choose the correct answer from the options given below:A certain plant homozygous for yellow seeds and red flowers was crossed with a plant homozygous for green seeds and white flowers. The F1 plants had yellow seeds and pink flowers. The F1 plants were selfed to get F2 progeny. Assuming independent assortment of the two characters, how many phenotypic categories are expected for these characters in the F2 generation?
+ 53 more questions in this chapterBrowse Chapter Questions
Morphology of Flowering Plants
Placentation, in which ovules develop on the inner wall of the ovary or in peripheral part, is:The negatively geotropic roots produced by Rhizophora are called:Given below are two statements. One is labelled as Assertion (A) and the other is labelled as Reason (R):
Assertion (A): A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason (R): Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:Identify the part of the seed from the given figure which is destined to form root when the seed germinates:Which of the following is the correct floral formula of Liliaceae?Identify the correct statements related to the androecium in the flower:
(a) Sterile stamens are called staminodes.
(b) When stamens are attached to petals, they are called epipetalous.
(c) Monoadelphous stamens are found in China rose.
(d) Polyadelphous stamens are found in Pea.
(e) Variation in the length of filaments is seen in Salvia and Mustard.Identify the correct set of statements:
(a) The leaflets are modified into pointed hard thorns in Citrus and Bougainvillea.
(b) Axillary buds form slender and spirally coiled tendrils in Cucumber and Pumpkin.
(c) Stem is flattened and fleshy in Opuntia and modified to perform the function of leaves.
(d) Rhizophora shows vertically upward growing roots that help to get oxygen for respiration.
(e) Subaerially growing stems in grasses and strawberry help in vegetative propagation.Pneumatophores occur in:
+ 45 more questions in this chapterBrowse Chapter Questions
Human Reproduction
Arrange the following male sex accessory ducts in the correct sequence for the transport of sperms from the testis:
(a) Vas deferens
(b) Urethral meatus
(c) Vasa efferentia
(d) Rete testis
(e) EpididymisWhich of the following events is not associated with ovulation in human females?Several hormones like hCG, hPL, oestrogen, progesterone are produced by:Which of the following statements are true for spermatogenesis but do not hold true for Oogenesis?Which of the following sets is similar in nature or function?The shared terminal duct of the reproductive and urinary system in the human male is:If for some reason, the vasa efferentia in the human reproductive system get blocked, the gametes will not be transported from:What happens during fertilisation in humans after many sperms reach close to the ovum?
+ 44 more questions in this chapterBrowse Chapter Questions
Microbes in Human Welfare
Which of the following is an example of a non-distilled alcoholic beverage produced by yeast?A high value of BOD (Biochemical Oxygen Demand) indicates that:Read the following statement having two blanks (A and B):
"A drug used for ______ (A)___ patients is obtained from a species of the organism ______ (B)___ ".
The one correct option for the two blanks is:
Blank-A Blank-BMatch the following microorganism with the product they produce:
Column I
(a) Trichoderma polysporum
(b) Monascus purpureus
(c) Streptococcus
(d) Saccharomyces cerevisiae
Column II
(i) Statins
(ii) Cyclosporin A
(iii) Ethanol
(iv) StreptokinaseAn organism used as a bio-fertilizer for raising soybean crop is:Match List-I with List-II relating to microbes and their products:
List-I (Microbes)
A. Streptococcus
B. Trichoderma polysporum
C. Monascus purpureus
D. Aspergillus niger
List-II (Products)
I. Citric acid
II. Clot buster
III. Cyclosporin A
IV. StatinsConversion of milk to curd improves its nutritional value by increasing the amount of?For a biocontrol agent to be part of an integrated pest management, it should be:
+ 36 more questions in this chapterBrowse Chapter Questions
Cell Cycle and Cell Division
If you are provided with the root tips of onion in your class and are asked to count the chromosomes, which of the following stages can you most conveniently look into?Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R)
Assertion (A): The growth of the multicellular organism is due to mitosis
Reason (R): Mitosis is also called as equational division and it offers genetic stabilityThe stage during which separation of the paired homologous chromosomes begins is:Synapsis occurs between:At which stage of the cell cycle does DNA replication occur:Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the option given below:Match List-I with List-II regarding the stages of Prophase-I (Meiosis I):
List-I (Event)
A. Chiasmata
B. Crossing over
C. Synaptonemal complex
D. Terminalisation of chiasmata
List-II (Stage)
I. Pachytene
II. Diakinesis
III. Diplotene
IV. ZygoteneIn the somatic cell cycle:
+ 21 more questions in this chapterBrowse Chapter Questions
Sexual Reproduction in Flowering Plants
A dioecious flowering plant prevents both:Double fertilization is:In some plants, the female gamete develops into an embryo without fertilization. This phenomenon is known as:To ensure that only the desired pollens fall on the stigma in artificial hybridization process:
a: the female flower buds of plant producing unisexual flower need not be bagged.
b: there is no need to emasculate unisexual flowers of selected female parent.
c: emasculated flowers are to be bagged immediately after cross pollination.
d: emasculated flowers are to be bagged after removal of anthers.
e: bisexual flowers, showing protogyny are never selected for cross.
Choose the correct answer from the options given below:Which of the following statements is not correct?In a cereal grain, the single cotyledon of the embryo is represented by:In which one of the following, both autogamy and geitonogamy are prevented?In general, the egg apparatus of the embryo sac in angiosperms consists of:
+ 20 more questions in this chapterBrowse Chapter Questions
Plant Growth and Development
Vernalisation stimulates flowering in:Spraying sugarcane crop with which of the following plant growth regulators, increases the length of the stem, thus, increasing the yield?The site of perception of light in plants during photoperiodism is:F. Skoog observed that callus proliferated from the internodal segments of tobacco stem when auxin was supplied with one of the following, except:Match List-I with List-II regarding plant growth regulators and their functions:One of the commonly used plant growth hormones in tea plantations is:Removal of apical dominance by decapitation is utilised for:The ability of plants to follow different pathways in response to environment leading to formation of different kinds of structures are called :
+ 16 more questions in this chapterBrowse Chapter Questions
Photosynthesis in Higher Plants
The first stable product of CO2 fixation in sorghum is:How many ATP and NADPH2 are required for the synthesis of one molecule of glucose during Calvin cycle?Phosphoenol pyruvate (PEP) is the primary CO2 acceptor in:Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
In the light of the above statements, choose the correct answer from the option given below:In Kranz anatomy, the bundle sheath cells have:How many molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle?Cyclic photophosphorylation results in the formation of:The ratio of carbon dioxide fixation between C4 plants and C3 plants is:
+ 15 more questions in this chapterBrowse Chapter Questions
Plant Kingdom
Moss peat is used as a packing material for sending flowers and live plants to distant places because:Which of the following plants produces seeds but not flowers:Which of the following statement is true for bryophyta:Given below are two statements : One is labelled as Assertion (A) and the other is labelled Reason (R):
Assertion (A): The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason (R): Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:In a moss the sporophyte:Read the following five statements (I to V) and select the option with all correct statements.
I: Mosses and lichens are the first organisms to colonise bare rock.
II: Selaginella is a homosporous pteridophyte.
III: Coralloid roots in Cycas have VAM.
IV: Main plant body in bryophytes is gametophytic, whereas in pteridophytes it is sporophytic.
V: In gymnosperms, male and female gametophytes are present within sporangia located on sporophytes.Match List-I with List-II
List-I
(A) Pteropsida
(B) Lycopsida
(C) Psilopsida
(D) Sphenopsida
List-II
(I) Psilotum
(II) Equisetum
(III) Adiantum
(IV) Selaginella
Choose the correct answer from the options given below:Which one of the following pairs of plants are not seed producers?
+ 14 more questions in this chapterBrowse Chapter Questions
Locomotion and Movement
Osteoporosis, an age-related disease of skeletal system, may occur due to:Which of the following is not a function of the skeletal system?Match List - I with List - II
List-I
(A) Palm bones
(B) Wrist bones
(C) Ankle bones
(D) Digit bones
List-II
(I) Phalanges
(II) Metacarpals
(III) Carpals
(IV) TarsalsThe H-zone in the skeletal muscle fibre is due to:Out of ‘X’ pairs of ribs in humans only 'Y' pairs are true ribs. Select the option that correctly represents values of X and Y and provides their explanation:Which of the following statements are correct regarding skeletal muscle?
A: Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B: Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C: Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D: M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:During muscular contraction, which of the following events occur?
(a) 'H' zone disappears
(b) 'A' band widens
(c) 'I' band reduces in width
(d) Myosin hydrolyzes ATP, releasing the ADP and Pi
(e) Z-lines attached to actins are pulled inwardsMatch List-I with List-II:
List-I
A. Vertebrochondral Ribs
B. Floating Ribs
C. Scapula
D. Coxal Bone
List-II
I. Ilium, Ischium, Pubis
II. 8th, 9th and 10th pairs of ribs
III. Acromion
IV. 11th and 12th pairs of ribs
+ 8 more questions in this chapterBrowse Chapter Questions
Respiration in Plants
Which of the following pairs is correctly matched regarding the Electron Transport System (ETS) complexes?Which of the following biomolecules is common to respiration-mediated breakdown of fats, carbohydrates and proteins?Which of these statements is incorrect?In glycolysis, the conversion of 1, 3-bisphosphoglyceric acid to 3-phosphoglyceric acid is:Match List-I with List-II regarding the site of occurrence of respiratory stages:
List-I
A. Citric acid cycle
B. Glycolysis
C. Electron transport
List-II
I. Cytoplasm
II. Mitochondrial matrix
IV. Inner mitochondrial membraneGiven below are two statements: One is labelled as Assertion (A) and the other is labelled as Reason (R):
Assertion (A): ATP is used at two steps in glycolysis.
Reason (R): First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below:What is the role of NAD+ in cellular respiration?Which statement is wrong for Krebs' cycle?
+ 7 more questions in this chapterBrowse Chapter Questions
Biotechnology and its Applications
Genetic engineering has been successfully used for producing:Which part would be most suitable for raising virus-free plants for micro propagation?The exploitation of bioresources of a nation by multinational companies without authorization from the concerned country is referred to as:To obtain virus-free healthy plants from a diseased one by tissue culture technique, which part/parts of the diseased plant will be taken?In Bt cotton, the Bt toxin present in plant tissue as pro-toxin is converted into active toxin due to:Human insulin is being commercially produced from a transgenic species of:Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A): In human beings, insulin is synthesized as a pro-hormone which needs to be processed before it becomes fully mature and functional.
Reason (R): The extra stretch of C-peptide is to be removed from A and B peptide chain of insulin.
In the light of the above statements, Choose the most appropriate answer from the option given below :Bt cotton variety that was developed by the introduction of toxin gene of Bacillus thuringiensis (BT) is resistant to:
+ 5 more questions in this chapterBrowse Chapter Questions
Body Fluids and Circulation
Persons with 'AB' blood group are called as "Universal recipients". This is due to:Which one of the following is correct?Given below is the ECG of a normal human. Which one of its components is correctly interpreted below?Given below are two statements:
Statement I: The coagulum is formed of network of threads called thrombins.
Statement II: Spleen is the graveyard of erythrocytes.
In the light of the above statements, choose the most appropriate answer from the options given below:The most popularly known blood grouping is the ABO grouping. It is named ABO and not ABC, because 'O' in it refers to having:What would be the heart rate of a person if the cardiac output is 5L, blood volume in the ventricles at the end of diastole is 100 mL and at the end of ventricular systole is 50 mL?Doctors use a stethoscope to hear the sounds produced during each cardiac cycle. The second sound is heard when:Arteries are best defined as the vessels which:
+ 4 more questions in this chapterBrowse Chapter Questions
Cell : The Unit of Life
Microtubules are the constituents of?Match List-I with List-II:
List-I
A. Axoneme
B. Cartwheel pattern
C. Crista
D. Satellite
List-II
I. Centriole
II. Cilia and flagella
III. Chromosome
IV. MitochondriaMatch List-I with List-II
List-I
A. Choanocytes
B. Scales
C. Comb plates
D. Radula
List-II
(i) Ctenophora
(ii) Mollusca
(iii) Porifera
(iv) ReptiliaWhich one of the following cell organelles is enclosed by a single membrane?Match List-I with List-II:
List-I
(a) Smooth muscle
(b) Tropomyosin
(c) Skull
(d) Red muscle
List-II
(i) Myoglobin
(ii) Thin filament
(iii) Sutures
(iv) InvoluntaryMatch List-I with List-II:
List-I
A. Metacentric chromosome
B. Sub-metacentric chromosome
C. Acrocentric chromosome
D. Telocentric chromosome
List-II
I. Chromosome has a terminal centromere
II. Middle centromere forming two equal arms of chromosome
III. Centromere is slightly away from the middle chromosome resulting into two unequal arms
IV. Centromere is situated close to its end forming one extremely short and one very long armMatch List-I with List-II.
List-I
A. Centromere
B. Cilium
C. Cristae
D. Cell membrane
List-II
I. Mitochondrion
II. Cell division
III. Cell movement
IV. Phospholipid BilayerMatch List-I with List-II.
List-I
A. F1 Particles
B. Histones
C. Axoneme
D. Cisternae
List-II
I. Chromosomes
II. Cilia
III. Golgi apparatus
IV. Mitochondria
+ 1 more questions in this chapterBrowse Chapter Questions
Chemical Coordination and Integration
Diuresis is prevented by:Which of the following are not under the control of thyroid hormone?Match List-I with List-II:
List-I
A. CCK
B. GIP
C. ANF
D. ADH
List-II
I. Kidney
II. Heart
III. Gastric gland
IV. PancreasMatch List-I with List-II:
List-I
A. Parathyroid hormone
B. Epinephrine and Nor-epinephrine
C. Thyroid stimulating hormone
D. Melatonin
List-II
I. Flight or fight response
II. Regulates the body's biological clock
III. Increases blood Ca2+ level
IV. Synthesis of hormonesWhich one of the following pairs correctly matches a hormone with a disease resulting from its deficiency?Which of the following statements are correct with respect to the hormone and its function?
A: Thyrocalcitonin (TCT) regulates the blood calcium level
B: In males, FSH and androgens regulate spermatogenesis
C: Hyperthyroidism can lead to goitre
D: Glucocorticoids are secreted in Adrenal Medulla
E: Parathyroid hormone is regulated by circulated levels of sodium ionsSelect the correct matching of a hormone, its source and its function:Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R).
Assertion (A): FSH which interacts with membrane bound receptors does not enter the target cell.
Reason (R): Binding of FSH to its receptors generates second messenger (cyclic AMP) for its biochemical and physiological responses.
In the light of the above statements, choose the most appropriate answer from the options given below:
Biological Classification
The imperfect fungi which are decomposers of litter and help in mineral cycling belong to?Which one of the following matches is correct?Select the correct combination of the statements (A-D) regarding the characteristics of certain organisms:
(A) Methanogens are archaebacteria which produce methane in marshy areas.
(B) Nostoc is a filamentous blue–green algae which fixes atmospheric nitrogen.
(C) Chemosynthetic autotrophic bacteria synthesize cellulose from glucose.
(D) Mycoplasma lack a cell wall and can survive without oxygen.In the five-kingdom classification, Chlamydomonas and Chlorella have been included in:Virus envelope is known as:Which, among the following, are the smallest living cells, known without a definite cell wall, pathogenic to plants as well as animals and can survive without oxygen?Which one single organism or the pair of organisms is correctly assigned to its or their named taxonomic group?
Neural Control and Coordination
Which of the following structures or regions is incorrectly paired with its function?Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:Match List-I with List-II:
List-I
A. Pons
B. Hypothalamus
C. Medulla
D. Cerebellum
List-II
I. Provides additional space for neurons, regulates posture and balance
II. Controls respiration and gastric secretions
III. Connects different regions of the brain
IV. Neurosecretory cellsMatch List-I with List-II:
List-I
A. Limbic system
B. Arachnoid
C. Corpus callosum
D. Hypothalamus
List-II
I. Body temperature
II. Tract of nerve fibres
III. Amygdala
IV. Cranial meningeMatch List-I with List-II:
List-I
(a) Ammonotelism
(b) Uricotelism
(c) Micturition
(d) ADH
List-II
(i) Birds
(ii) Water reabsorption
(iii) Bony fish
(iv) Urinary bladder
Explore Other NEET Question Banks
Why 32,000+ students choose TopperSquare
Everything you need to crack NEET
15,000+ Chapter MCQs
Physics, Chemistry, Biology — chapter-wise, topic-wise practice
AI Performance Analytics
Know your weak topics. Get a personalised study plan.
Full NEET Mock Tests
180 questions, timed, with detailed score analysis
PYQ Sets 2010–2024
15 years of past papers with solved explanations
No credit card · 30-second signup · Free forever plan included