Question
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
3' ATCGATCGATCGATCGATCGATCGATCG 5'
5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
5' ATCGATCGATCGATCGATCGATCGATCG 3'
the coding strand has the polarity 5'→3' and the sequence is the same as RNA (except that thymine is present in place of uracil). Therefore, if the mRNA sequence is 5'-AUCG...-3', the coding strand will be 5'-ATCG...-3'. The strand with 3'→5' polarity acts as the template.
This question aligns with the NEET BIOLOGY syllabus, specifically targeting concepts from Molecular Basis of Inheritance. Mastering this topic is crucial for scoring well in the upcoming medical entrance examinations. Solving conceptually related problems will help you understand the nuances of these concepts and improve your problem-solving speed.
More Molecular Basis of Inheritance Questions
Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?
The method of DNA replication in which two strands of DNA separate and synthesize new strands is called:
Which one of the following experiments of Frederick Griffith resulted in the discovery of bacterial transformation?
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II: DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In light of the above statements, choose the most appropriate answer from the options given below:
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Which experimental material was used by Taylor and colleagues to prove that DNA in chromosomes replicates semiconservatively?
Which of the following is not a cloning vector?
The association of histone H1 with a nucleosome indicates:
Why 32,000+ students choose TopperSquare
15,000+ Chapter MCQs
Physics, Chemistry, Biology — chapter-wise, topic-wise practice
AI Performance Analytics
Know your weak topics. Get a personalised study plan.
Full NEET Mock Tests
180 questions, timed, with detailed score analysis
PYQ Sets 2010–2024
15 years of past papers with solved explanations
No credit card · 30-second signup · Free forever plan included
This neet biology practice question is part of the TopperSquare free question bank. TopperSquare offers 15,000+ chapter-wise NEET MCQs across Physics, Chemistry, and Biology with detailed step-by-step explanations, full mock tests, NEET PYQs (2010–2024), and an AI-powered performance analytics dashboard. browse all neet practice questions → · practice biology sets →
Sign in to save your score, view detailed analytics, and bookmark tough questions for revision.
Sign In / Join FreeChapter-wise practice sets
Identify weak areas instantly
Step-by-step logic for every question