Question Bank Directory

Browse and search thousands of solved questions for your preparation.

Free · Highly Important · 15,000+ MCQs

NEET Chapter-Wise Practice Questions

Free questions with full explanations — locked behind signup to protect quality.

Browse All
Found 5998 questions
BIOLOGYReproductive HealthEasy

A childless couple can be assisted to have a child through a technique called GIFT. The full form of this technique is:

View Full Solution
BIOLOGYReproductive HealthEasy

Hysterectomy is surgical removal of:

View Full Solution
BIOLOGYReproductive HealthEasy

Tubectomy is a method of sterilisation in which:

View Full Solution
PHYSICSNUCLEIEasy

In the given nuclear reaction, the element X is: ${}^{22}_{11}\mathrm{Na} \rightarrow X + e^+ + \nu$

View Full Solution
PHYSICSEasy

A step down transformer connected to an ac mains supply of 220 V is made to operate at 11 V, 44 W lamp. Ignoring power losses in the transformer, what is the current in the primary circuit?

View Full Solution
BIOLOGYReproductive HealthMedium

Given below are four methods (A-D) and their modes of action (1-4) in achieving contraception. Select their correct matching from the four options that follow: Column I A. The Pill B. Condom C. Vasectomy D. Copper T Column II 1. Prevents sperms reaching cervix 2. Suppress sperm motility 3. Prevents ovulation 4. Semen contains no sperms

View Full Solution
PHYSICSELECTROMAGNETIC WAVESEasy

A parallel plate capacitor of capacitance 20 μF is being charged by a voltage source whose potential is changing at the rate of 3 V/s. The conduction current through the connecting wires, and the displacement current through the plates of the capacitor would be, respectively:

View Full Solution
BIOLOGYReproductive HealthMedium

Which of the following is correct regarding HIV, hepatitis B, gonorrhoea, trichomoniasis?

View Full Solution
CHEMISTRYAldehydes, Ketones and Carboxylic AcidsMedium

Identify the product in the following reaction:

View Full Solution
PHYSICSNUCLEIEasy

A nucleus with mass number 240 breaks into fragments each of mass number 120. The binding energy per nucleon of unfragmented nuclei is 7.6 MeV while that of fragments is 8.5 MeV. The total gain in the binding energy in the process is:

View Full Solution
PHYSICSNUCLEIEasy

In a radioactive substance at t = 0, the number of atoms is $8 \times 10^4$. Its half-life period is 3 yr. The number of atoms equal to $1 \times 10^4$ will remain after an interval of:

View Full Solution
BIOLOGYReproductive HealthMedium

Cu released by CuTs plays a role in:

View Full Solution
PHYSICSATOMSEasy

When a hydrogen atom is in its first excited level, its radius is:

View Full Solution
BIOLOGYReproductive HealthMedium

What is false for ZIFT?

View Full Solution
BIOLOGYReproductive HealthEasy

Which of the following diseases is/are not completely curable?

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

The experimental proof for semiconservative replication of DNA was first shown in a:

View Full Solution
PHYSICSOscillationsMedium

A body performs simple harmonic motion about $x=0$ with an amplitude $a$ and a time period $T$. The speed of the body at $x=\frac{a}{2}$ will be:

View Full Solution
BIOLOGYMolecular Basis of InheritanceEasy

Commonly used vectors for human genome sequencing are:

View Full Solution
PreviousPage 162 of 300Next