Browse and search thousands of solved questions for your preparation.
Free questions with full explanations — locked behind signup to protect quality.
A childless couple can be assisted to have a child through a technique called GIFT. The full form of this technique is:
Hysterectomy is surgical removal of:
Tubectomy is a method of sterilisation in which:
In the given nuclear reaction, the element X is: ${}^{22}_{11}\mathrm{Na} \rightarrow X + e^+ + \nu$
A step down transformer connected to an ac mains supply of 220 V is made to operate at 11 V, 44 W lamp. Ignoring power losses in the transformer, what is the current in the primary circuit?
Given below are four methods (A-D) and their modes of action (1-4) in achieving contraception. Select their correct matching from the four options that follow: Column I A. The Pill B. Condom C. Vasectomy D. Copper T Column II 1. Prevents sperms reaching cervix 2. Suppress sperm motility 3. Prevents ovulation 4. Semen contains no sperms
A parallel plate capacitor of capacitance 20 μF is being charged by a voltage source whose potential is changing at the rate of 3 V/s. The conduction current through the connecting wires, and the displacement current through the plates of the capacitor would be, respectively:
Which of the following is correct regarding HIV, hepatitis B, gonorrhoea, trichomoniasis?
Identify the product in the following reaction:
A nucleus with mass number 240 breaks into fragments each of mass number 120. The binding energy per nucleon of unfragmented nuclei is 7.6 MeV while that of fragments is 8.5 MeV. The total gain in the binding energy in the process is:
In a radioactive substance at t = 0, the number of atoms is $8 \times 10^4$. Its half-life period is 3 yr. The number of atoms equal to $1 \times 10^4$ will remain after an interval of:
Cu released by CuTs plays a role in:
When a hydrogen atom is in its first excited level, its radius is:
What is false for ZIFT?
Which of the following diseases is/are not completely curable?
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately:
The experimental proof for semiconservative replication of DNA was first shown in a:
A body performs simple harmonic motion about $x=0$ with an amplitude $a$ and a time period $T$. The speed of the body at $x=\frac{a}{2}$ will be:
Commonly used vectors for human genome sequencing are: