Question
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?
5' UAGCUAGCUAGCUAGCUAGCUAGC UAGC 3'
3' UAGCUAGCUAGCUAGCUAGCUAGC UAGC 5'
5' ATCGATCGATCGATCGATCGATCG ATCG 3'
3' ATCGATCGATCGATCGATCGATCG ATCG 5'
The coding strand of DNA has the same sequence as the mRNA, except that Thymine (T) replaces Uracil (U). Given mRNA: 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'. The coding strand will be: 5' ATCGATCGATCGATCGATCGATCG ATCG 3'.
This question aligns with the NEET BIOLOGY syllabus, specifically targeting concepts from General. Mastering this topic is crucial for scoring well in the upcoming medical entrance examinations. Solving conceptually related problems will help you understand the nuances of these concepts and improve your problem-solving speed.
More BIOLOGY Questions
What is the full form of IUDs?
Given below are two statements: Statement I: The primary source of energy in an ecosystem is solar energy. Statement II: The rate of production of organic matter photosynthesis in an ecosystem is called net primary productivity (NPP). In the light of the above statements, choose the most appropriate answer from the options given below.
Which one of the following is not a method of in situ conservation of biodiversity?
A 'new' variety of rice was patented by a foreign company though such varieties have been present in India for a long time. This is related to?
Given below are two statements: Statement I: In an ecosystem, there is unidirectional flow of energy of sun from producers to consumers. Statement II: Ecosystems are exempted from 2nd law of thermodynamics. In the light of the above statements, choose the most appropriate answer from the options given below:
The site of perception of light in plants during photoperiodism is
In RNAi, the genes are silenced using:
Consider the pyramid of energy of an ecosystem given below : If T4 is equivalent to 1000 J, what is the value of T1?
Why 32,000+ students choose TopperSquare
15,000+ Chapter MCQs
Physics, Chemistry, Biology — chapter-wise, topic-wise practice
AI Performance Analytics
Know your weak topics. Get a personalised study plan.
Full NEET Mock Tests
180 questions, timed, with detailed score analysis
PYQ Sets 2010–2024
15 years of past papers with solved explanations
No credit card · 30-second signup · Free forever plan included
This neet biology practice question is part of the TopperSquare free question bank. TopperSquare offers 15,000+ chapter-wise NEET MCQs across Physics, Chemistry, and Biology with detailed step-by-step explanations, full mock tests, NEET PYQs (2010–2024), and an AI-powered performance analytics dashboard. browse all neet practice questions → · practice biology sets →
Sign in to save your score, view detailed analytics, and bookmark tough questions for revision.
Sign In / Join FreeChapter-wise practice sets
Identify weak areas instantly
Step-by-step logic for every question