Browse and search thousands of solved questions for your preparation.
Free questions with full explanations — locked behind signup to protect quality.
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:
Which one of the following is NOT an advantage of inbreeding?
Given below are two statements: Statement I : During $G_0$ phase of cell cycle, the cell is metabolically inactive. Statement II : The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?
Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:
Match List I with List II. List I: A. Mast cells, B. Inner surface of bronchiole, C. Blood, D. Tubular parts of nephron. List II: I. Ciliated epithelium, II. Areolar connective tissue, III. Cuboidal epithelium, IV. Specialised connective tissue. Choose the correct answer from the options give below:
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the options given below:
The type of tissue commonly found in the fruit wall of nuts is:
Cortex is the region found between:
In the given figure of a stomatal apparatus, which component has thin outer walls and highly thickened inner walls?
Plants having little or no secondary growth are:
Initiation of lateral roots and vascular cambium during secondary growth takes place in cells of:
Find the statement that is NOT correct with regard to the structure of monocot stem.
Casparian strips occur in:
Which one of the following organisms is scientifically correctly named according to international rules of nomenclature?
Which of the following statements is/are correct?
X and Y are the components of Binomial Nomenclature. Identify X and Y and who proposed this naming system
Match the following columns and select the correct option: Column-I: (a) Chlamydomonas, (b) Cycas, (c) Selaginella, (d) Sphagnum Column-II: (i) Moss, (ii) Pteridophyte, (iii) Algae, (iv) Gymnosperm
Match List-I with List-II: List-I (a) Chlamydomonas (b) Cycas (c) Selaginella (d) Sphagnum List-II (i) Moss (ii) Pteridophyte (iii) Algae (iv) Gymnosperm Choose the correct answer from the options given below: