Question Bank Directory

Browse and search thousands of solved questions for your preparation.

Free · Highly Important · 15,000+ MCQs

NEET Chapter-Wise Practice Questions

Free questions with full explanations — locked behind signup to protect quality.

Browse All
Found 1968 questionsFilter: biology
BIOLOGYEasy

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

View Full Solution
BIOLOGYHard

Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:

View Full Solution
BIOLOGYMedium

Which one of the following is NOT an advantage of inbreeding?

View Full Solution
BIOLOGYMedium

Given below are two statements: Statement I : During $G_0$ phase of cell cycle, the cell is metabolically inactive. Statement II : The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the options given below:

View Full Solution
BIOLOGYMedium

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'?

View Full Solution
BIOLOGYMedium

Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome. Choose the correct answer from the options given below:

View Full Solution
BIOLOGYMedium

Match List I with List II. List I: A. Mast cells, B. Inner surface of bronchiole, C. Blood, D. Tubular parts of nephron. List II: I. Ciliated epithelium, II. Areolar connective tissue, III. Cuboidal epithelium, IV. Specialised connective tissue. Choose the correct answer from the options give below:

View Full Solution
BIOLOGYMedium

Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:

View Full Solution
BIOLOGYMedium

Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophils are agranulocytes Choose the correct answer from the options given below:

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

The type of tissue commonly found in the fruit wall of nuts is:

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

Cortex is the region found between:

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

In the given figure of a stomatal apparatus, which component has thin outer walls and highly thickened inner walls?

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

Plants having little or no secondary growth are:

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

Initiation of lateral roots and vascular cambium during secondary growth takes place in cells of:

View Full Solution
BIOLOGYAnatomy of Flowering Plants Medium

Find the statement that is NOT correct with regard to the structure of monocot stem.

View Full Solution
BIOLOGYAnatomy of Flowering Plants Easy

Casparian strips occur in:

View Full Solution
BIOLOGYThe Living WorldMedium

Which one of the following organisms is scientifically correctly named according to international rules of nomenclature?

View Full Solution
BIOLOGYThe Living WorldMedium

Which of the following statements is/are correct?

View Full Solution
BIOLOGYThe Living WorldMedium

X and Y are the components of Binomial Nomenclature. Identify X and Y and who proposed this naming system

View Full Solution
BIOLOGYAnimal KingdomEasy

Match the following columns and select the correct option: Column-I: (a) Chlamydomonas, (b) Cycas, (c) Selaginella, (d) Sphagnum Column-II: (i) Moss, (ii) Pteridophyte, (iii) Algae, (iv) Gymnosperm

View Full Solution
PreviousPage 85 of 99Next