Browse and search thousands of solved questions for your preparation.
Free questions with full explanations — locked behind signup to protect quality.
Given below are two statements: Statement I: The codon 'AUG' codes for methionine and phenylalanine. Statement II: 'AAA' and 'AAG' are both codons that code for the amino acid lysine. In light of the above statements, choose the correct answer from the options given below:
During DNA replication, Okazaki fragments are used to elongate:
A molecule that can act as a genetic material must fulfill the traits given below, except:
Chargaff's rule states that in an organism:
Match List-I with List-II relating to the genes of the lac operon and their gene products: List-I (a) i gene (b) z gene (c) a gene (d) y gene List-II (i) Beta-galactosidase (ii) Permease (iii) Repressor (iv) Transacetylase
Which of the following is the initiation codon:
Match List I with List II regarding the lac operon genes and their products: List I (Genes) List II (Products) A. Gene 'a' I. Beta-galactosidase B. Gene 'y' II. Transacetylase C. Gene 'i' III. Permease D. Gene 'z' IV. Repressor protein
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Natural selection where more individuals acquire specific character value other than the mean character value, leads to:
Domestic sewage in large cities:
With reference to Hershey and Chase experiments, select the correct statements: A: Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. B: Viruses grown on radioactive sulphur contained radioactive proteins. C: Viruses grown on radioactive phosphorus contained radioactive protein D: Viruses grown on radioactive sulphur contained radioactive DNA E: Viruses grown on radioactive protein contained radioactive DNA
Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octamer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix
Given below are statements regarding RNA polymerase in prokaryotes: Statement I: In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II: RNA polymerase associates transiently with 'Rho' factor to initiate transcription. In the light of the above statements, choose the correct answer from options given below:
Given below are four statements (A-D) each with one or two blanks. Select the option which correctly fills up the blanks in two statements. Statements: (A) Wings of butterflies and birds look alike and are the results of (i)____, evolution. (B) Miller showed that CH4, H2, NH3, and (i)____, when exposed to electric discharge in a flask resulted in the formation of (ii)____. (C) Vermiform appendix is a (i)____ organ and an (ii)____ evidence of evolution. (D) According to Darwin evolution took place due to (i)____ and (ii)____ of the fittest.
Identify the correct statement:
During the replication of bacterial chromosomes, DNA synthesis starts from a replication origin site and:
Amino acid sequence in protein synthesis is decided by the sequence of:
Which one of the following sequences was proposed by Darwin and Wallace for organic evolution?
The output ($Y$) of the given logic gate is similar to the output of an/a:
The esters that get hydrolyzed most easily under alkaline conditions is?